I held the future of data storage in my hands and it couldn’t look weirder – 2024 could be the year DNA storage goes mainstream and it couldn’t come sooner
This is a hands-on “review” like no other. This is a product that currently has no equivalent and yet is so limited in scope that there is no real market for it. However, don't underestimate its impact: DNA storage is the future of data storage and it cannot be otherwise given the current growth rate of global data production, new use cases such as generative AI and the amount of power that comes with producing and storing bytes.
Ny Breaking has written extensively about this exciting new medium and I believe 2024 could be the year DNA storage matures, with major storage players like Microsoft and Seagate providing timelines and validating this market. Forget glass, ceramic, silicon, holograms and so many other exotic storage media; DNA is the real deal.
French startup Biomemory became the first company to ship a DNA storage device to the general public. With an initial launch sticker price of 1,000 euros and a capacity of 1 KB, this is more of a proof of concept. The card I received is already loaded with a read-only message: Citius, Altius, Fortius – Communiter (Faster, Higher, Stronger – Together), the motto of the modern Olympic Games, to be held in 2024 in Paris, France, Biomemory's home city.
The above paragraph is 476 bytes long and would translate into a set of corresponding fundamental building blocks (e.g. AGACAGTCAGTGACTCAGTC). After purchasing the card, you can send your text and test your data retrieval using a free sequencing process from Eurofins Genomics. This is a destructive process, resulting in the loss of one DNA card. Therefore, two copies are provided.
The medium I received was a brushed metal plate about the size of a credit card with the text on it Biomemory logo stamped top right: the card itself is approximately 4mm thick and weighs approximately 30g. The actual DNA storage is a black circle with a diameter of approximately 8 mm. Other than keeping it in a safe place, you can't do anything with it. You can read, copy or write on it. There are two notches on the back to help extract the DNA, as well as two QR codes and a unique ID. The two cards included a letter from the CEO of Biomemory.
Future iterations will likely be very different in capacity, size and speed. By 2026, Biomemory plans to launch a 100 PB self-embedded DNA card with a price tag of $150,000 and 1,000 PB (one Exabyte) by the end of this decade.
The cheapest storage media at the time of writing – LTO tapes – cost about $4 per TB or $400,000 for 100 PB, not including CAPEX/OPEX costs associated with physical storage, power consumption, and processing of approximately 8,000 LTO-8 tapes.
The company's CEO, Erfane Arwani, cited write speeds of 3MB per second using a separate read module. That's just under 11 GB per hour or 96 TB per year. It would take 1000 years to fill the 100 PB map, although exponential improvements in read/write speeds are likely to reduce this by several orders of magnitude. Remember that the actual media will never change (DNA is immutable after all), but the interface will evolve as interfaces and ports have over the decades (e.g. MCA to PCI-e or ATA to NVMe).